Journals

Journals By Subject

Life Sciences, Agriculture & Food
Chemistry
Medicine & Health
Materials Science
Mathematics & Physics
Electrical & Computer Science
Earth, Energy & Environment
Architecture & Civil Engineering
Education
Economics & Management
Humanities & Social Sciences
Multidisciplinary

Special Issues

Propose a Special Issue
Special Issue Guidelines
Ongoing Special Issues
Published Special Issues

Join Us

Become the Founding Editor-in-Chief
Join as Editor-in-Chief
Join as Senior Editor
Join as Editorial Board Member
Become a Reviewer
Submit an Article
Research Article | | Peer-Reviewed

Genetic Diversity and Clonal Dissemination of ESBL-Producing Klebsiella pneumoniae from Clinical, Food, and Animal Sources in Bouaké, Côte d’Ivoire

Nonfra Marie Tuo*,  Gnagra Marie-Thérèse Wognin,  Abdoulaye Diarrassouba,  Chantal Akoua-Koffi
Published in American Journal of BioScience (Volume 14, Issue 5)
Received: 13 August 2026     Accepted: 31 August 2026     Published: 9 October 2026
Views:       Downloads:
Download PDF
Abstract

Klebsiella pneumoniae is a major opportunistic pathogen responsible for multidrug-resistant infections in both hospital and community settings. The emergence and spread of extended-spectrum β-lactamase (ESBL)-producing strains have become a major public health concern due to limited treatment options and their potential spread among human, animal, and food reservoirs. This study aimed to assess the genetic relatedness of ESBL-producing K. pneumoniae isolates collected from human clinical samples, ready-to-eat foods, and animal sources using ERIC-PCR profiling. A total of 98 ESBL-producing K. pneumoniae isolates were included, comprising 96 clinical isolates from hospitalized (n = 91) and non-hospitalized (n = 5) patients at Bouaké University Hospital, one isolate from ready-to-eat food, and one isolate from raw cow’s milk. Identification was performed using conventional bacteriological methods, and ESBL production was confirmed using CHROMagar ESBL medium and the double-disk synergy test. ERIC-PCR analysis revealed a high level of genetic diversity, with 25 distinct ERIC profiles identified, including nine common types and 16 unique types. Several dominant clonal lineages were observed among the clinical isolates, distributed across different hospital departments and outpatient settings. One foodborne isolate shared an ERIC profile identical to that of three clinical isolates, while the animal-derived isolate exhibited a unique genotype. Overall, most isolates showed genetic heterogeneity, although clonal dissemination was observed among hospital strains. These results indicate a predominance of ESBL-producing K. pneumoniae in the hospital setting and suggest limited genetic relatedness between human and non-human isolates. However, the interpretation of relationships involving food and animal isolates remains limited by their low representation in the study. These results underscore the importance of strengthening infection prevention and control measures and confirm the need for ongoing molecular surveillance of multidrug-resistant K. pneumoniae.

Published in American Journal of BioScience (Volume 14, Issue 5)
DOI 10.11648/j.ajbio.20261405.11
Page(s) 105-110
Creative Commons

This is an Open Access article, distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution and reproduction in any medium or format, provided the original work is properly cited.

Copyright

Copyright © The Author(s), 2026. Published by Science Publishing Group
Previous article
Keywords

Animal, Human, Ready-to-Eat Food, ESBL, Klebsiella pneumoniae, ERIC-PCR

1. Introduction
Enterobacteriaceae are a large family of Gram-negative bacilli living in the digestive tract of humans and certain healthy animals
[1]
. They play an important role in human pathology and are among the most frequently isolated Gram-negative bacteria in clinical microbiology laboratories
[2]
. Infections caused by Enterobacteriaceae constitute a major public health problem because treatment options are increasingly compromised by resistance to several antibiotic classes, particularly β-lactam antibiotics, which remain among the most widely prescribed antibacterial agents worldwide
[3]
. The main mechanism of resistance of enterobacteria to β-lactamins is the production of ESBL, an enzyme that inactivates almost all molecules in this family of antibiotics
[4]
. In addition, ESBL-producing strains are frequently accompanied by multidrug resistance to different therapeutic classes
[5]
. The presence of this type of resistance mechanism in pathogenic strains poses a major risk of therapeutic inadequacy and hence therapeutic failure, and is also a factor of diffusion
[6]
.
Among these enterobacteria is Klebsiella pneumoniae (K. pneumoniae), a hospital pathogen responsible for about one-third of all Gram-negative infections
[7]
. It is associated with high patient morbidity and mortality
[8]
. K. pneumoniae is characterized by the presence of a thick polysaccharide capsule that complicates its detection by the host immune system
[9]
.
For a long time associated only with hospitals, the epidemiology of ESBL-producing strains of K. pneumoniae has changed considerably since the years 2000
[10]
. Since then, these ESBL strains have been spreading in the community, in food-producing animals and even in ready-to-eat foods, threatening food safety
[10, 11]
. This epidemic phenomenon is particularly worrying because of its rapid spread and geographical extent
[10]
. Food, being one of the main routes of introduction of antibiotic-resistant bacteria and their genes into the human digestive tract
[12]
, consumption of contaminated food could therefore influence the diversity of antibiotic resistance genes in the gut
[13]
. In addition, these bacteria can transfer antibiotic resistance determinants to other pathogenic bacteria
[14]
.
In this context, molecular epidemiological tools are essential to assess the genetic relatedness of isolates from different sources and to better understand transmission dynamics. Such approaches provide critical insights into whether ESBL-producing strains circulating in hospitals, animals, and food belong to shared or distinct clonal lineages.
The present study aimed to investigate the genetic relatedness of ESBL-producing Klebsiella pneumoniae isolates recovered from human clinical samples, food, and animal sources using molecular typing methods, in order to assess their genetic diversity and explore potential links between these reservoirs.
2. Materials and Methods
2.1. Strains Collection
A total of 98 ESBL-producing Klebsiella pneumoniae isolates were recovered from different sources during January 2015 to June 2017. Of these, 91 clinical isolates were obtained from hospitalized patients (n = 91) distributed across ten hospital wards, whereas 5 isolates were obtained from non-hospitalized patients in the outpatient setting. One isolate was recovered from a ready-to-eat food sample purchased from street vendors, and one isolate was obtained from raw cow's milk collected from dairy farms. Bacterial strains were identified using matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry (Maldi Biotyper, Bruker Daltonics; Bremen, Germany). The screening of ESBL-producing Klebsiella pneumoniae strains was performed using CHROMagar™ ESBL medium and the double-disk synergy test (DDST)
[15-17]
.
2.2. DNA Extraction
Genomic DNA was extracted by the simple boiling method as previously described
[18]
. Briefly, K. pneumoniae isolates were cultured on Mueller Hinton agar (Merck, Germany) and incubated at 37°C. After 24 hours, one to five colonies were suspended in distilled water, and suspension was boiled for 30 min at 95°C in water bath. The suspension was centrifuged at 14,000 rpm for five min and the supernatant transferred to filter columns. After a final centrifugation at 1200 rpm for five min, the supernatant was transferred to filter columns. After a final centrifugation at 1200 rpm for five min, the supernatant was transferred to a new microtube and stored at -20°C.
2.3. ERIC-PCR
K. pneumoniae isolates were fingerprinted using the enterobacterial repetitive intergenic consensus polymerase chain reaction (ERIC-PCR). The primers used for the ERIC-PCR reaction were ERIC-1 (5′ TGTAAGCTCCTGG GGATTCAC 3′) and ERIC-2 (5′ AAGTAAGTGACTGGGGTGAGCG 3′)
[19]
. PCR amplification was performed in a reaction mixture of 25 μL, and the cycling conditions were as follows: an initial denaturation at 94°C for 5 min, followed by 35 cycles of denaturation at 95°C for 1 min, annealing at 52°C for 1 min, extension at 72°C for 5 min and a final extension at 72°C for 10 min. PCR products were separated by electrophoresis on 2% agarose gels and visualized using a gel documentation system (Vilber Lourmat, France) after staining with GelRed®. Products sizes were estimated using 100 bp to 10 000 pb DNA ladders as molecular size markers (Thermo Scientific).
2.4. ERIC-PCR Profiles Analysis
The ERIC patterns were analyzed by online data analysis service (insilico.ehu.es). ERIC profiles were compared using Dice method and clustered by UPGMA (unweighted pair group method with arithmetic mean) program and finally, the dendogram was drawn
[19]
.
3. Results
Analysis of the electrophoretic profiles of the DNA fragments obtained after PCR amplification showed a variation in the number of bands between 6 and 15 according to the strain, with sizes ranging from 100 bp to 10,000 bp. The gel image of the isolates is given in Figure 1.
M: molecular size marker; 1, 2, 3,….: bacterial strains

Download: Download full-size image

Figure 1. ERIC-PCR profiles from ESBL-producing-Klebsiella pneumoniae.
Clonal diversity was observed among 98 ESBL producing K. pneumoniae isolates by detecting 25 ERIC patterns (ERIC -types), nine of which were common type (A, B, C, D, E, J, L, W, X) and sixteen unique type. ERIC-type X was identified as the dominant type, with 18 isolates belonging to it originating from six inpatient wards and the outpatient ward. In addition, ERIC-type L had 17 strains isolated from patients also from six inpatient wards and the outpatient ward. Fourteen K. pneumoniae strains from five inpatient ward and the outpatient ward showed ERIC-type W. Genotype B was observed in 13 strains sharing the same origin as genotype W. ERIC-type C strains (five strains) came from 3 different inpatient wards, as did ERIC-type A strains (four strains). The strain isolated from ready-to-eat food and three strains from three inpatient wards had ERIC-type J. ERIC-type D and ERIC-type E each included 3 strains from different inpatient wards. As for the strain isolated from raw cow's milk, it had only one genotype of its own. The Dendogram of K. pneumoniae isolates clustering based on ERIC patterns is given in Figure 2.
Figure 2. Dendogram of 98 K. pneumoniae isolates clustering based on ERIC patterns.
Ec. ready-to-eat food isolate, LV. raw cow's milk isolate, Kp. Clinical isolate
4. Discussion
Investigation of the genetic relatedness of 98 ESBL-producing strains of K. pneumoniae, including 96 clinical strains, one foodborne strain and one strain of animal origin, showed a genetic diversity of these strains characterized by 25 distinct genotypes. Similar results have been obtained in previous studies by several researchers, including Abe et al. in Côte d'Ivoire
[20]
, Moosavian and Emam in Iran
[21]
and Firmo et al. in Brazil
[22]
.
Of these 98 strains, 82 showed common profiles differentiated into nine genotypes. This could suggest a similar origin of dissemination. Each of these nine genotypes comprised between 4 and 18 strains from the same and different departments. Similar results have been reported by several researchers in their studies of enterobacterial strains of nosocomial origin
[23, 24]
. These findings may be explained by clonal dissemination within hospital wards, potentially associated with inadequate hygiene practices and the predominant mode of transmission of K. pneumoniae, particularly via hand-mediated spread.
In addition, a common genotype was identified in the food BLSE strain isolated from cooked cow's milk and three human clinical strains from the Pediatrics, Neurology and Surgical Emergency wards. These three clinical strains were isolated from urine and pus samples. This result indicates the genetic homogeneity of these strains. Several researchers, including Giri et al.
[11]
, have demonstrated the good discriminatory power and typing capacity of ERIC-PCR for bacterial isolates of human and food origin. The same applies for Tang et al.
[25]
, whose study showed genetic homogeneity between isolates of human and food origin. According to Bray et Zafar
[26]
, the acquisition and gastrointestinal carriage of K. pneumoniae ESBL is an important intermediate step in the process of developing K. pneumoniae ESBL infections in patients, and may also serve to perpetuate a large reservoir of organisms within the hospital. These findings are consistent with those reported by Tsitsos et al.
[27]
, who investigated ESBL- and carbapenemase-producing K. pneumoniae, Escherichia coli, and Acinetobacter spp. in patients and kitchen environments of two Greek hospitals. Their study identified antimicrobial-resistant K. pneumoniae in kitchen-associated samples and demonstrated epidemiological relatedness between some isolates recovered from the kitchen environment and hospitalized patients. These findings suggest that hospital kitchens may act as potential reservoirs and sites of circulation of antimicrobial-resistant bacteria, thereby contributing to their dissemination within healthcare facilities
[27]
. In addition, Parmar et al.
[28]
demonstrated a clonal relationship between K. pneumoniae isolates recovered from broilers and their handlers, suggesting possible transmission through direct contact and highlighting the role of poultry production environments in the dissemination of ESBL-producing K. pneumoniae. Modeling studies have also identified cross-contamination in a kitchen as a primary source of exposure to foodborne bacteria
[29]
. Therefore, good hand and kitchen hygiene are key control points for reducing the risk of exposure to foodborne bacterial pathogens such as K. pneumoniae.
In the present study, distinct genotypes were observed among the 15 human clinical strains and the single animal-origin strain, indicating genetic heterogeneity among these isolates. Similar genetic diversity has been reported among Klebsiella isolates recovered from human, animal, and environmental sources in a genomic One Health study conducted in Ghana
[30]
. Conversely, close genetic relatedness between human- and animal-origin K. pneumoniae has also been reported. Menezes et al.
[31]
, using whole-genome sequencing, identified transmission of ESBL-producing K. pneumoniae strains between companion animals and their cohabiting humans. Similarly, comparative genomic analysis of K. pneumoniae from the poultry production chain identified closely related multidrug-resistant lineages shared between poultry and human clinical isolates
[32]
.
A major limitation of this study lies in the very limited number of isolates of animal and food origin included. Consequently, the observed genetic similarities should be interpreted with caution, as a larger and more representative sampling from non-clinical sources would be necessary to better assess the potential role of the food chain and animal reservoirs in the dissemination of ESBL-producing K. pneumoniae.
5. Conclusions
This study highlights significant genetic diversity among ESBL-producing Klebsiella pneumoniae isolates, as well as the presence of several dominant clonal lineages circulating among patients in various wards at Bouaké University Hospital in Côte d’Ivoire. These findings indicate significant clonal dissemination within the hospital environment, suggesting ongoing nosocomial transmission of multidrug-resistant strains. Limited genetic similarity was observed between a foodborne isolate and a small number of clinical isolates; however, this finding should be interpreted with caution due to the very limited number of non-clinical isolates analyzed. Overall, these results highlight the hospital’s role as the primary reservoir of ESBL-producing K. pneumoniae in this study and underscore the need to strengthen infection prevention and control measures to limit their spread.
Abbreviations

E. coli

Escherichia Coli

ERIC-PCR

Enterobacterial Repetitive Intergenic Consensus Polymerase Chain Reaction

ESBL

Extended-Spectrum Beta-Lactamase

K. pneumoniae

Klebsiella Pneumoniae
Author Contributions
Nonfra Marie Tuo: Conceptualization, Data curation, Formal Analysis, Investigation, Methodology, Writing – original draft
Gnagra Marie-Thérèse Wognin: Writing – review & editing
Abdoulaye Diarrassouba: Supervision
Chantal Akoua-Koffi: Validation
Conflicts of Interest
The authors declare no conflicts of interest.
References
[1] Morales-Lopez, S., Yepes, J. A., Prada-Herrera, J. C., Torres-Jiménez, A. Enterobacteria in the 21st century: a review focused on taxonomic changes. The Journal of Infection of Developing Countries. 2019, 13: 265-273.

https://doi.org/10.3855/jidc.11216

[2] Janda, J. M., Abbott, S. L. 2021. The Changing Face of the Family Enterobacteriaceae (Order: “Enterobacterales”): New Members, Taxonomic Issues, Geographic Expansion, and New Diseases and Disease Syndromes. Clinical Microbiology Reviews 34: 10.1128/cmr.00174-20.

https://doi.org/10.1128/cmr.00174-20

[3] De Angelis, G., Del Giacomo, P., Posteraro, B., Sanguinetti, M., & Tumbarello, M. Molecular Mechanisms, Epidemiology, and Clinical Importance of β-Lactam Resistance in Enterobacteriaceae. International Journal of Molecular Sciences. 2020, 21: 5090.

https://doi.org/10.3390/ijms21145090

[4] Hadi, H. A., Al-Hail, H., Aboidris, L. E., Al-Orphaly, M., Ahmed, M. A. S., Samuel, B. G., Mohamed, H. A., Sultan, A. A., Skariah, S. Prevalence and genetic characterization of clinically relevant extended-spectrum β-lactamase-producing Enterobacterales in the Gulf Cooperation Council countries. Frontiers in Antibiotics. 2023, 2: 1177954.

https://doi.org/10.3389/frabi.2023.1177954

[5] Khadka, C., Shyaula, M., Syangtan, G., Bista, S., Tuladhar, R., Singh, A., Joshi, D. R., Pokhrel, L. R., Dawadi, P. Extended-spectrum β-lactamases producing Enterobacteriaceae (ESBL-PE) prevalence in Nepal: A systematic review and meta-analysis. Sci Total Environ. 2023, 901: 166164.

https://doi.org/10.1016/j.scitotenv.2023.166164

[6] Beaumont, A., Danjean, M., Jacquier, H., Boyd, A., Jaspard, M., Royer, G., Surgers, L., Woerther, P. 0. Dissemination of ESBL-producing Escherichia coli and carriage in the community worldwide: epidemiology, transmission pathways, molecular insights, and practical aspects. Clinical Microbiology Reviews 0: e00274-25.

https://doi.org/10.1128/cmr.00274-25

[7] Karami-Zarandi, M., Rahdar, H. A., Esmaeili, H., Ranjbar, R. Klebsiella pneumoniae: an update on antibiotic resistance mechanisms. Future Microbiology. 2023: 65-81.

https://doi.org/10.2217/fmb-2022-0097

[8] Li, D., Huang, X., Rao, H., Yu, H., Long, S., Li, Y., Zhang, J. Klebsiella pneumoniae bacteremia mortality: a systematic review and meta-analysis. Frontiers in Cellular and Infection Microbiology. 2023, 13: 1157010.

https://doi.org/10.3389/fcimb.2023.1157010

[9] Xu, Q., Xie, M., Liu, X., Heng, H., Wang, H., Chan, W-C. E., Zhang R., Yang, G., Chen S. Molecular mechanisms underlying the high mortality of hypervirulent Klebsiella pneumoniae and its effective therapy development. Signal Transduction and Targeted Therapy. 2023, 8: 221.

https://doi.org/10.1038/s41392-023-01490-9

[10] Wareth, G., Neubauer, H. The Animal-foods-environment interface of Klebsiella pneumoniae in Germany: an observational study on pathogenicity, resistance development and the current situation. Veterinary Research. 2021, 52: 16.

https://doi.org/10.1186/s13567-020-00875-w

[11] Giri, S.; Kudva, V.; Shetty, K.; Shetty, V. Prevalence and Characterization of Extended-Spectrum β-Lactamase-Producing Antibiotic-Resistant Escherichia coli and Klebsiella pneumoniae in Ready-to-Eat Street Foods. Antibiotics. 2021, 10, 850.

https://doi.org/10.3390/antibiotics10070850

[12] Kujat, C. S., Neumann, E. M., Romero-Barrios, P., Tamber, S. Contribution of Food to the Human Health Burden of Antimicrobial Resistance. Foodborne Pathogens Disease. 2024, 21: 71-82.

https://doi.org/10.1089/fpd.2023.0099

[13] Diaz-Amigo, C., Bartolomé, D. P. L., Lejeune, J., Pinto, F. J., Bessy, C. Antimicrobial resistance and the human gut microbiome-a food safety perspective. Critical Revieuws in Food Science and Nutrition. 2026, 66: 4819-4847.

https://doi.org/10.1080/10408398.2026.2629533

[14] Zinno, P., Perozzi, G., Devirgiliis, C. Foodborne Microbial Communities as Potential Reservoirs of Antimicrobial Resistance Genes for Pathogens: A Critical Review of the Recent Literature. Microorganisms. 2023, 11: 1696.

https://doi.org/10.3390/microorganisms11071696

[15] European Committee on Antimicrobial Susceptibility Testing (EUCAST), Version 7.1. Breakpoint tables for interpretation of MICs and zone diameters. 2017.
[16] Allouch, P-Y., Pangon, B., Ghnassia, J-C. Antibiogramme des entérobactéries. Revue Française des Laboratoires. 1995, 279: 25-30.

https://doi.org/10.1016/S0338-9898%2895%2980249-5

[17] Zaniani, F. R., Meshkat, Z., Naderi, N. M., Khaje-Karamadini, M., Ghazvini, K., Rezaee, A., Esmaily, H., Nabavinia, M. S., Darban, H. M. The Prevalence of TEM and SHV Genes among Extended-Spectrum Beta-Lactamases Producing Escherichia Coli and Klebsiella Pneumoniae. Iranian Journal Basic Medical Sciences. 2012, 15: 654-660.

https://doi.org/10.22038/ijbms.2012.4834

[18] Coudron, P. E., Moland, E. S., Thomson, K. S. Occurrence and detection of AmpC beta-lactamases among Escherichia coli, Klebsiella pneumoniae, and Proteus mirabilis isolates at a veterans medical center. Journal of Clinical Microbiology. 2000, 38: 1791-1796.

https://doi.org/10.1128/jcm.38.5.1791-1796.2000

[19] Zarei, O., Shokoohizadeh, L., Hossainpour, H., Alikhani, M. Y. Molecular analysis of Pseudomonas aeruginosa isolated from clinical, environmental and cockroach sources by ERIC-PCR. BMC Research Notes. 2018, 11: 668.

https://doi.org/10.1186/s13104-018-3765-z

[20] Abe, I., N’Djetchi, M., Traore, M., Yao, F., Konan, T., Sokouri, P., Konate, I., Koffi, M. Impact of Genetic Diversity of Uropathogenic Escherichia coli and Klebsiella pneumoniae Strains on the Dissemination of Extended Spectrum Beta-Lactam Resistance Genes in Côte d’Ivoire. American Journal of Molecular Biology. 2024, 14: 230-244.

https://doi.org/10.4236/ajmb.2024.144017

[21] Moosavian, M., Emam, N. The first report of emerging mobilized colistinresistance (mcr) genes and ERIC-PCR typing in Escherichia coli and Klebsiella pneumoniae clinical isolates in southwest Iran. Infection of Drug Resistance. 2019, 12: 1001-1010.

https://doi.org/10.2147/idr.s192597

[22] Firmo, E. F., Beltrão, E. M. B., da Silva, F. R. F., Alves, L. C., Brayner, F. A., Veras, D. L., Lopes, A., C. Association of blaNDM-1 with blaKPC-2 and aminoglycosidemodifying enzyme genes among Klebsiella pneumoniae, Proteus mirabilis and Serratia marcescens clinical isolates in Brazil. Journal of Global Antimicrobial Resistance. 2020, 21: 255-261.

https://doi.org/10.1016/j.jgar.2019.08.026

[23] Kundu, J., Kansal, S., Rathore, S., Kaundal, M., Angrup, A., Biswal, M., Walia, K., Ray, P. Evaluation of ERIC-PCR and MALDI-TOF as typing tools for multidrug resistant Klebsiella pneumoniae clinical isolates from a tertiary care center in India. PLoS One. 2022, 17: e0271652.

https://doi.org/10.1371/journal.pone.0271652

[24] Ikhimiukor, O. O., Zac Soligno, N. I., Akintayo, I. J., Zac Soligno, N. I., Akintayo, I. J., Marcovici, M. M., Souza, S. S. R., Workman, A., Martin I. W., Andam C. P. Clonal background and routes of plasmid transmission underlie antimicrobial resistance features of bloodstream Klebsiella pneumoniae. Nature Communications. 2024, 15: 6969.

https://doi.org/10.1038/s41467-024-51374-x

[25] Tang, F., Chen, Z., Zhu, H., Xi, L., Li, C., Luo, W., Genetic relatedness, antibiotic resistance, and virulence of Klebsiella pneumoniae isolated from health care and food sources in Wuhan, China, American Journal of Infection Control. 2024, 52: 1043-1051.

https://doi.org/10.1016/j.ajic.2024.05.011

[26] Bray, A. S., Zafar, M. A. Deciphering the gastrointestinal carriage of Klebsiella pneumoniae. Infection and Immunity. 2024, 92: e00482-23.

https://doi.org/10.1128/iai.00482-23

[27] Calbo, E., Freixas, N., Xercavins, M., Riera, M., Nicolás, C., Monistrol, O., Solé, M. D. L., Sala, M. R., Vila, J., Rarau, G. Foodborne nosocomial outbreak of SHV1 and CTX-M-15–producing Klebsiella pneumoniae: epidemiology and control. Clinical Infectious Diseases. 2011, 52: 743-749.

https://doi.org/10.1093/cid/ciq238

[28] Parmar, N., Singh, R., Kaur, S., Tyagi, A., Malik, H., Aulakh, R. S., Gill J. P. S., Unraveling genetic similarities of Klebsiella pneumoniae from poultry and poultry handlers in Punjab, India, Gene Reports. 2025, 38: 102101.

https://doi.org/10.1016/j.genrep.2024.102101

[29] Iulietto, M. F., Evers, E. G. Cross-contamination in the kitchen: A model for quantitative microbiological risk assessment. Risk Analysis. 2024, 44: 1156-1175.

https://doi.org/10.1111/risa.14232

[30] Calland, J. K., Haukka, K., Kpordze S. W., Brusah, A., Corbella, M., Merla, C., Samuelsen, Ø., Feil, E. J., Sassera, D., Karikari, A. B., Saba, C. K. S., Thorpe H. A., Corander J. Population structure and antimicrobial resistance among Klebsiella isolates sampled from human, animal, and environmental sources in Ghana: a cross-sectional genomic One Health study, The Lancet Microbe. 2023, 4: e943-e952.

https://doi.org/10.1016/S2666-5247(23)00208-2

[31] Menezes, J., Frosini, S-M., Weese, S., Perreten, V., Schwarz, S., Amaral, A. J., Loeffler, A., Pomba, C. Transmission dynamics of ESBL/AmpC and carbapenemase-producing Enterobacterales between companion animals and humans. Frontiers in Microbiology. 2024, 15: 1432240.

https://doi.org/10.3389/fmicb.2024.1432240

[32] Mourão, J., Magalhães, M., Ribeiro-Almeida, M., Rebelo, A., Novais, C., Peixe, L. Novais  and Antunes P (2024) Decoding Klebsiella pneumoniae in poultry chain: unveiling genetic landscape, antibiotic resistance, and biocide tolerance in non-clinical reservoirs. Frontiers in Microbiology. 2024, 15: 1365011.

https://doi.org/10.3389/fmicb.2024.1365011

Cite This Article
Plain Text BibTeX RIS

  • APA Style

    Tuo, N. M., Wognin, G. M., Diarrassouba, A., Akoua-Koffi, C. (2026). Genetic Diversity and Clonal Dissemination of ESBL-Producing Klebsiella pneumoniae from Clinical, Food, and Animal Sources in Bouaké, Côte d’Ivoire. American Journal of BioScience, 14(5), 105-110. https://doi.org/10.11648/j.ajbio.20261405.11

    Copy | Download

    ACS Style

    Tuo, N. M.; Wognin, G. M.; Diarrassouba, A.; Akoua-Koffi, C. Genetic Diversity and Clonal Dissemination of ESBL-Producing Klebsiella pneumoniae from Clinical, Food, and Animal Sources in Bouaké, Côte d’Ivoire. Am. J. BioScience 2026, 14(5), 105-110. doi: 10.11648/j.ajbio.20261405.11

    Copy | Download

    AMA Style

    Tuo NM, Wognin GM, Diarrassouba A, Akoua-Koffi C. Genetic Diversity and Clonal Dissemination of ESBL-Producing Klebsiella pneumoniae from Clinical, Food, and Animal Sources in Bouaké, Côte d’Ivoire. Am J BioScience. 2026;14(5):105-110. doi: 10.11648/j.ajbio.20261405.11

    Copy | Download 

  • @article{10.11648/j.ajbio.20261405.11,
  author = {Nonfra Marie Tuo and Gnagra Marie-Thérèse Wognin and Abdoulaye Diarrassouba and Chantal Akoua-Koffi},
  title = {Genetic Diversity and Clonal Dissemination of 
ESBL-Producing Klebsiella pneumoniae from Clinical, Food, and Animal Sources in Bouaké, Côte d’Ivoire},
  journal = {American Journal of BioScience},
  volume = {14},
  number = {5},
  pages = {105-110},
  doi = {10.11648/j.ajbio.20261405.11},
  url = {https://doi.org/10.11648/j.ajbio.20261405.11},
  eprint = {https://article.sciencepublishinggroup.com/pdf/10.11648.j.ajbio.20261405.11},
  abstract = {Klebsiella pneumoniae is a major opportunistic pathogen responsible for multidrug-resistant infections in both hospital and community settings. The emergence and spread of extended-spectrum β-lactamase (ESBL)-producing strains have become a major public health concern due to limited treatment options and their potential spread among human, animal, and food reservoirs. This study aimed to assess the genetic relatedness of ESBL-producing K. pneumoniae isolates collected from human clinical samples, ready-to-eat foods, and animal sources using ERIC-PCR profiling. A total of 98 ESBL-producing K. pneumoniae isolates were included, comprising 96 clinical isolates from hospitalized (n = 91) and non-hospitalized (n = 5) patients at Bouaké University Hospital, one isolate from ready-to-eat food, and one isolate from raw cow’s milk. Identification was performed using conventional bacteriological methods, and ESBL production was confirmed using CHROMagar ESBL medium and the double-disk synergy test. ERIC-PCR analysis revealed a high level of genetic diversity, with 25 distinct ERIC profiles identified, including nine common types and 16 unique types. Several dominant clonal lineages were observed among the clinical isolates, distributed across different hospital departments and outpatient settings. One foodborne isolate shared an ERIC profile identical to that of three clinical isolates, while the animal-derived isolate exhibited a unique genotype. Overall, most isolates showed genetic heterogeneity, although clonal dissemination was observed among hospital strains. These results indicate a predominance of ESBL-producing K. pneumoniae in the hospital setting and suggest limited genetic relatedness between human and non-human isolates. However, the interpretation of relationships involving food and animal isolates remains limited by their low representation in the study. These results underscore the importance of strengthening infection prevention and control measures and confirm the need for ongoing molecular surveillance of multidrug-resistant K. pneumoniae.},
 year = {2026}
}

    Copy | Download 

  • TY  - JOUR
T1  - Genetic Diversity and Clonal Dissemination of 
ESBL-Producing Klebsiella pneumoniae from Clinical, Food, and Animal Sources in Bouaké, Côte d’Ivoire
AU  - Nonfra Marie Tuo
AU  - Gnagra Marie-Thérèse Wognin
AU  - Abdoulaye Diarrassouba
AU  - Chantal Akoua-Koffi
Y1  - 2026/10/09
PY  - 2026
N1  - https://doi.org/10.11648/j.ajbio.20261405.11
DO  - 10.11648/j.ajbio.20261405.11
T2  - American Journal of BioScience
JF  - American Journal of BioScience
JO  - American Journal of BioScience
SP  - 105
EP  - 110
PB  - Science Publishing Group
SN  - 2330-0167
UR  - https://doi.org/10.11648/j.ajbio.20261405.11
AB  - Klebsiella pneumoniae is a major opportunistic pathogen responsible for multidrug-resistant infections in both hospital and community settings. The emergence and spread of extended-spectrum β-lactamase (ESBL)-producing strains have become a major public health concern due to limited treatment options and their potential spread among human, animal, and food reservoirs. This study aimed to assess the genetic relatedness of ESBL-producing K. pneumoniae isolates collected from human clinical samples, ready-to-eat foods, and animal sources using ERIC-PCR profiling. A total of 98 ESBL-producing K. pneumoniae isolates were included, comprising 96 clinical isolates from hospitalized (n = 91) and non-hospitalized (n = 5) patients at Bouaké University Hospital, one isolate from ready-to-eat food, and one isolate from raw cow’s milk. Identification was performed using conventional bacteriological methods, and ESBL production was confirmed using CHROMagar ESBL medium and the double-disk synergy test. ERIC-PCR analysis revealed a high level of genetic diversity, with 25 distinct ERIC profiles identified, including nine common types and 16 unique types. Several dominant clonal lineages were observed among the clinical isolates, distributed across different hospital departments and outpatient settings. One foodborne isolate shared an ERIC profile identical to that of three clinical isolates, while the animal-derived isolate exhibited a unique genotype. Overall, most isolates showed genetic heterogeneity, although clonal dissemination was observed among hospital strains. These results indicate a predominance of ESBL-producing K. pneumoniae in the hospital setting and suggest limited genetic relatedness between human and non-human isolates. However, the interpretation of relationships involving food and animal isolates remains limited by their low representation in the study. These results underscore the importance of strengthening infection prevention and control measures and confirm the need for ongoing molecular surveillance of multidrug-resistant K. pneumoniae.
VL  - 14
IS  - 5
ER  -

    Copy | Download

Author Information

  • Nonfra Marie Tuo

    Department of Biotechnology and Food Safety, Felix Houphouet-Boigny University, Abidjan, Côte d’Ivoire

    Contact Email

    http://orcid.org/0009-0003-1629-9465

  • Gnagra Marie-Thérèse Wognin

    Department of Genetics and Breeding, National Center for Agronomic Research (CNRA), Bouaké, Côte d’Ivoire

    http://orcid.org/0009-0008-1847-8826

  • Abdoulaye Diarrassouba

    Department of Basic and Bioclinical Sciences, Alassane Ouattara University, Bouaké, Côte d’Ivoire;Laboratory of Bacteriology-Virology, University Hospital, Bouaké, Côte d’Ivoire

    http://orcid.org/0009-0001-0538-1602

  • Chantal Akoua-Koffi

    Department of Basic and Bioclinical Sciences, Alassane Ouattara University, Bouaké, Côte d’Ivoire;Laboratory of Bacteriology-Virology, University Hospital, Bouaké, Côte d’Ivoire

    http://orcid.org/0000-0003-0975-6632

Download PDF
Submit an Article

About Us

Science Publishing Group (SciencePG) is an Open Access publisher, with more than 300 online, peer-reviewed journals covering a wide range of academic disciplines.

Learn More About SciencePG

Products

Information

Important Link

Copyright © 2012 -- 2026 Science Publishing Group – All rights reserved.